bbs1 digestion  (New England Biolabs)

Journal: Synthetic Biology

Article Title: biGMamAct: efficient CRISPR/Cas9-mediated docking of large functional DNA cargoes at the ACTB locus

doi: 10.1093/synbio/ysaf003

Figure Lengend Snippet: biGMamAct plasmid library

Article Snippet: ACTB sgRNA cloning is achieved by annealing two ssDNA primers ( ACTB _For 5ʹ CACCGACAGCTCCCCACACACCAC 3ʹ and ACTB _Rev 5ʹ AAACGTGGTGTGTGGGGAGCTGTC 3ʹ) and subsequent ligation in a Bbs1-digested pX458 (Addgene #48138).

Techniques: Plasmid Preparation

Journal: Synthetic Biology

Article Title: biGMamAct: efficient CRISPR/Cas9-mediated docking of large functional DNA cargoes at the ACTB locus

doi: 10.1093/synbio/ysaf003

Figure Lengend Snippet: (a) biGMamAct assembly. GOIs inserted into the psLIB shuttle plasmids of the biGMamAct expression system can be PCR amplified using the standard bioinformatically designed primers of the biGBac system for further assembly into the recipient psBIG1a ACTB T2ATetP2AP-mAGH leading to all-in-one pDONOR generation. (b) KI design. Cotransfection of the pDONOR 6colors plasmid with a Cas9-containing one targeting ACTB locus will lead to pDONOR stable and precise integration via HITI at the ACTB locus with high efficiency. Indeed, ACTB sgRNA targeted sequence is present in reverse orientation in pDONOR for linearization by Cas9 endonuclease and orientation-controlled integration in the genome. sgRNA target sequence and resulting junctions are depicted (PAM is underlined, and DNA sequence from pDONOR in bold). (C) Cloning validation. Agarose gels showing recombining and positive pDONOR 6colors clones (left) and correct sgRNA ACTB cloning in pX458 (right).

Article Snippet: ACTB sgRNA cloning is achieved by annealing two ssDNA primers ( ACTB _For 5ʹ CACCGACAGCTCCCCACACACCAC 3ʹ and ACTB _Rev 5ʹ AAACGTGGTGTGTGGGGAGCTGTC 3ʹ) and subsequent ligation in a Bbs1-digested pX458 (Addgene #48138).

Techniques: Expressing, Amplification, Cotransfection, Plasmid Preparation, Sequencing, Cloning, Biomarker Discovery, Clone Assay

Journal: Genes

Article Title: Heterozygous Knockout of ARID4B Using CRISPR/Cas9 Attenuates Some Aggressive Phenotypes in a Breast Cancer Cell Line.

doi: 10.3390/genes14122184

Figure Lengend Snippet: Figure 2. Construction and validation of the CRISPR/Cas9 system. (A) The structure of the ARID4B protein with a total of 1312 amino acids and the site where the mutations were generated in position 939, indicated as a hotspot. (B) Design of the sgRNA and validation of the ligation in the pX459 vector by Sanger sequencing. Only underlined region is shown. Red for T, Black for G, Blue for C, and Green for A. (C) Confirmation of the presence of genetic editions in the pool of MCF-7 cells after transfection. The surveyor assay produces a cut in the PCR product, generating two fragments indicated by arrows. (D) Validation of the presence of genetic editions in isolated clones. Here, 3, 10, and 21 represent the clones positive for mutations in ARID4B.

Article Snippet: Both oligos were aligned and cloned in Bbs1 digested pX459 (62988, Addgene, Cambridge, MA, USA).

Techniques: Biomarker Discovery, CRISPR, Generated, Ligation, Plasmid Preparation, Sequencing, Transfection, Isolation, Clone Assay